Indexing sequence files with Biopython

The forthcoming release of Biopython 1.52 will include a couple of nice improvements to the Bio.SeqIO module, and here we’re going to introduce the new index function. This will of course be covered in the Biopython Tutorial & Cookbook (PDF) once this code is released.

Suppose you have a large sequence file with many many individual sequences in it. This could be next generation sequence data for example, maybe a FASTQ, FASTA or QUAL file. Or, it might be a big annotation rich file, such as the whole of UniProt, or a chunk of GenBank.

The Bio.SeqIO.parse(…) function lets you iterate over all the records in a file, one by one. This allows you to process each sequence in turn, keeping only one in memory at a time. This approach is very valuable for dealing with big files.

However, sometimes you can’t just loop over the records in the order found in the file. You may require random access. In Python, the natural API here is a dictionary – for example looking up the records via their ID string. This is how the existing Bio.SeqIO.to_dict(…) function works. It is just a helper function to build an in memory dictionary of a collection of SeqRecord objects. However, because everything is kept in memory (RAM), this only works on small or medium sized files. :(

So, what should you do when you have a very large file, and it is no longer possible to load everything into memory at once? Well, you might consider using a BioSQL database – this is probably quite a sensible option for something like GenBank data. However, for next generation sequencing data this is probably overkill. This is where the new Bio.SeqIO.index(…) function comes in. It behaves like a Python dictionary, but doesn’t keep everything in memory at once!

What Bio.SeqIO.index(…) does is first quickly scan the file looking for the position of each new record, and records this information against the record ID string. This still requires a reasonable amount of memory, but works fine even for millions of entries in a file. Then, when you ask for a particular record, it jumps to the relevant part of the file, and then parses the data into a SeqRecord.

For example, consider the FASTQ file SRR014849.fastq (available compressed at the NCBI). The Bio.SeqIO.index(…) function takes a minimum of two arguments, the filename and the file format:


>>> from Bio import SeqIO
>>> data = SeqIO.index("SRR014849.fastq", "fastq")
>>> len(data)
94696
>>> data.keys()[:3]
['SRR014849.80961', 'SRR014849.80960', 'SRR014849.80963']
>>> print data["SRR014849.290838"].seq
TGAGAATTTTTATTTTCAAGGGTTGGAACCGAAGGGTTTGAATTCAAACCCTTTCGGTTCCAACCCGACAAGTCATCGATGTTG
>>> print data["SRR014849.290838"].letter_annotations["phred_quality"]
[20, 18, 24, 25, 33, 26, 37, 33, 22, 11, 1, 22, 37, 33, 22, 10, 25, 31, 26, 36, 32, 16, 33, 26, 31, 25, 33, 25, 31, 25, 22, 33, 26, 35, 30, 12, 35, 31, 17, 19, 30, 20, 33, 26, 27, 31, 27, 6, 36, 32, 15, 33, 29, 10, 27, 32, 24, 30, 25, 30, 20, 24, 13, 35, 31, 13, 27, 26, 28, 32, 24, 28, 28, 27, 22, 22, 26, 28, 26, 24, 27, 30, 22, 27]

In this case the FASTQ file is only 24MB (so the example is easy to try at home), but the same approach works just as well on a 1GB FASTQ file :)

This will be covered in more detail by the new edition of the Biopython Tutorial & Cookbook, and once you have Biopython 1.52 or later installed don’t forget about the built in help:

>>> from Bio import SeqIO
>>> help(SeqIO.index)
...

Biopython 1.52 will index most of the file formats that can already be parsed with the SeqIO library – but not any multiple alignment formats. There is a table on the Bio.SeqIO wiki page.

Enjoy!

Peter

P.S. Note that random access to all the records in a sequence file isn’t the only potential benefit of using Bio.SeqIO.index(…). Suppose you are only interested in a few entries in a large file. You could use a for loop with Bio.SeqIO.parse(…), but this will mean every single record gets parsed and turned into a SeqRecord. If instead you used Bio.SeqIO.index(…) then only the few records you care about get parsed and turned into SeqRecord objects. This can save a lot of time, especially for an annotation rich format like SwissProt or GenBank.

This entry was posted in Biopython, Blogroll, Code, Development, Documentation, HOWTO, OBF Projects and tagged , . Bookmark the permalink.

Comments are closed.